Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 64210729 64223135 enh3280

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 64217498 rs551115516 TTTCTATCGTTTTACTTTACCACTAA T 3602146
chr14 64217512 rs549891422 C T 3602147
chr14 64217545 rs566629660 C CT 3602148
chr14 64217612 rs569749492 T C 3602149
chr14 64217626 rs112147343 T A 3602150
chr14 64217723 rs565945972 G C 3602151
chr14 64217739 rs182340987 C T 3602152
chr14 64217756 rs567692238 G A 3602153
chr14 64217764 rs536343199 G C 3602154
chr14 64217816 rs576468089 C A 3602155
chr14 64217861 rs552246591 AC A 3602156

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results