EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr14:72219863-72220084]
Chromosome characteristics of ZZZ3[chr14:72219863-72220084]
Back to top
Enhancers possibly regulated by ZZZ3[chr14:72219863-72220084]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 72216005 72226535 enh31019
Bone Marrow (K562) Cervix (HeLa-S3) Brain (SK-N-MC) Astrocyte Bone (Osteoblast) Muscle (A673) Muscle (Myoblast) Pancreas (Panc1) Epithelial (MCF-7)
SNP sites on ZZZ3[chr14:72219863-72220084]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 72219901 rs140627507 G A 3647728
chr14 72220031 rs562474790 G A 3647729
chr14 72220036 rs554646993 A AGCGCGTTTCCCTCCTGATTC 3647730
chr14 72220060 rs58697123 T C 3647731
chr14 72220071 rs11624769 G T 3647732
Genes possibly regulated by ZZZ3[chr14:72219863-72220084]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr14:72219863-72220084]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results