Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 76758325 76763375 enh51883

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 76760419 rs529049743 C CTGTGGGGGAGGTTCTGCCTTCTCCCACTCCCTGGTTTAA 3671355
chr14 76760473 rs143161830 C A,T 3671356
chr14 76760480 rs147168271 C T 3671357
chr14 76760499 rs140364491 T C,G 3671358
chr14 76760506 rs77662013 G C 3671359
chr14 76760529 rs58387926 C T 3671360
chr14 76760587 rs73308685 C T 3671361
chr14 76760623 rs58063382 C A 3671362
chr14 76760644 rs56207842 G T 3671363

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results