Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 99238605 99247555 enh3443

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 99246816 rs139629507 CTCATTGATTTGCCTTGTGGCTT C 3776599
chr14 99246816 rs368801330 CTCATTGATTTGCCTTGTGGCTT C 3776600
chr14 99247056 rs10136601 G A 3776601
chr14 99247122 rs368906879 G A 3776602
chr14 99247162 rs560329820 GA G 3776603

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results