EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr14:99246746-99247223]
Chromosome characteristics of ZNF143[chr14:99246746-99247223]
Back to top
Enhancers possibly regulated by ZNF143[chr14:99246746-99247223]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 99238605 99247555 enh3443
Blood (Karpas-422) Epithelial (MCF-7)
SNP sites on ZNF143[chr14:99246746-99247223]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 99246816 rs139629507 CTCATTGATTTGCCTTGTGGCTT C 3776599
chr14 99246816 rs368801330 CTCATTGATTTGCCTTGTGGCTT C 3776600
chr14 99247056 rs10136601 G A 3776601
chr14 99247122 rs368906879 G A 3776602
chr14 99247162 rs560329820 GA G 3776603
Genes possibly regulated by ZNF143[chr14:99246746-99247223]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr14:99246746-99247223]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results