Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 99271025 99277075 enh96555

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 99274795 rs534354736 G A 3776925
chr14 99274869 rs557175046 CCTCTGTCCCTCCCTTCTTCCCTGT C 3776926
chr14 99274874 rs547826248 G C 3776927
chr14 99274937 rs74082806 T C 3776928
chr14 99274943 rs139011634 G A 3776929
chr14 99274996 rs116768156 G A 3776930

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results