EnhancerDB
  1. Home
  2. TFBS
  3. ZNF217[chr15:63712695-63713265]
Chromosome characteristics of ZNF217[chr15:63712695-63713265]
Back to top
Enhancers possibly regulated by ZNF217[chr15:63712695-63713265]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 63710505 63714975 enh52044
Bone Marrow (K562) Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-MC) Large Intestine Epithelial (MCF-7)
SNP sites on ZNF217[chr15:63712695-63713265]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 63712767 rs533425840 T C 4019559
chr15 63712821 rs374406202 A AT 4019560
chr15 63712912 rs569920511 CTT C 4019561
chr15 63712940 rs567417544 A T 4019562
chr15 63712956 rs57560192 T G 4019563
chr15 63712965 rs577208455 G A 4019564
chr15 63713020 rs544710675 TTAATATATATGCATTTACAAGCA T 4019565
Genes possibly regulated by ZNF217[chr15:63712695-63713265]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF217[chr15:63712695-63713265]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results