EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr16:1950471-1951048]
Chromosome characteristics of ZNF143[chr16:1950471-1951048]
Back to top
Enhancers possibly regulated by ZNF143[chr16:1950471-1951048]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 1947689 1952655 enh52191
Large Intestine Esophagus Peripheral Blood (MM.1S) Pancreas Epithelial (MCF-7)
SNP sites on ZNF143[chr16:1950471-1951048]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 1950479 rs2917519 C A 4258459
chr16 1950498 rs2982455 T A,C,G 4258460
chr16 1950522 rs75496807 G A,C 4258461
chr16 1950538 rs111249901 GGCCGAAGGGACATGGCAGCAGCA G 4258462
chr16 1950538 rs372459112 GGCCGAAGGGACATGGCAGCAGCA G 4258463
chr16 1950561 rs534934319 A G 4258464
chr16 1950669 rs556869738 A C 4258465
chr16 1950671 rs181614941 C G 4258466
chr16 1950836 rs140398458 C T 4258467
Genes possibly regulated by ZNF143[chr16:1950471-1951048]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr16:1950471-1951048]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results