EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:12911695-12912216]
Chromosome characteristics of ZNF274[chr16:12911695-12912216]
Back to top
Enhancers possibly regulated by ZNF274[chr16:12911695-12912216]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 12908185 12915435 enh16565
Placenta Liver (HepG2) Lung (PC-9)
SNP sites on ZNF274[chr16:12911695-12912216]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 12911777 rs142152373 G C 4334433
chr16 12911844 rs151190919 A G 4334434
chr16 12911896 rs145293727 C T 4334435
chr16 12911971 rs115062378 A G 4334436
chr16 12912000 rs9302491 T C 4334437
chr16 12912011 rs182618748 C T 4334438
chr16 12912012 rs9939649 G A 4334439
chr16 12912096 rs9930438 A G 4334440
chr16 12912108 rs140907635 CCCTGTCTCTACTAAAAATA C 4334441
chr16 12912108 rs72209117 CCCTGTCTCTACTAAAAATA C 4334442
chr16 12912126 rs547135384 T G 4334443
chr16 12912127 rs564148394 A C 4334444
chr16 12912159 rs10163447 G A 4334445
Genes possibly regulated by ZNF274[chr16:12911695-12912216]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:12911695-12912216]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results