Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 19997445 20001595 enh96666

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 19997165 rs138635469 C A,T 4364870
chr16 19997170 rs115697569 C T 4364871
chr16 19997206 rs116195575 G A 4364872
chr16 19997235 rs545687139 A G 4364873
chr16 19997371 rs75251591 G A 4364874
chr16 19997459 rs146210696 T A 4364875
chr16 19997806 rs560419034 CATGGTGTATGTCCCAGGTGAGCCA C 4364876
chr16 19997836 rs554402412 G A 4364877
chr16 19997929 rs28693570 T G 4364878
chr16 19997947 rs11863036 G T 4364879
chr16 19998028 rs187097457 A G 4364880
chr16 19998243 rs571709111 C G 4364881
chr16 19998311 rs28461566 C G 4364882

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results