Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 27393645 27402961 enh87045

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 27397226 rs1107789 C A 4395655
chr16 27397235 rs1107788 G A 4395656
chr16 27397420 rs62030021 G A 4395657
chr16 27397422 rs370240804 G A 4395658
chr16 27397496 rs184082905 T C 4395659
chr16 27397539 rs11074854 G C 4395660
chr16 27397554 rs189096096 C G 4395661
chr16 27397619 rs534986276 A AAACTCCCTGGTGTCTCTTCTTATAAGGGCACT 4395662

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results