Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 68232087 68238215 enh4104
chr16 68234152 68234458 vista22807

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 68234060 rs527353057 C T 4499515
chr16 68234118 rs539120324 C T 4499516
chr16 68234484 rs143341991 A G 4499517
chr16 68234498 rs568337163 G A 4499518
chr16 68234681 rs186579536 T C 4499519
chr16 68234976 rs533572904 A G 4499520
chr16 68235052 rs9746872 A C 4499521
chr16 68235211 rs564164639 G T 4499522
chr16 68235271 rs567994476 A C 4499523
chr16 68235300 rs73612242 G A 4499524
chr16 68235322 rs539253194 T A 4499525
chr16 68235371 rs557579632 G T 4499526
chr16 68235534 rs377420883 TTTTG T 4499527
chr16 68235551 rs74624207 A T 4499528
chr16 68235664 rs560089291 G A 4499529
chr16 68235705 rs201574156 A AG 4499530
chr16 68235731 rs532816237 CATGCCTGTAGTCCCAGCTACTTGGGAGGCTGGCATAGGAGAA C 4499531

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results