Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 84278445 84283755 enh81156

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 84281654 rs55770557 C T 4605554
chr16 84281713 rs56404799 G C 4605555
chr16 84281739 rs59760888 C T 4605556
chr16 84281750 rs150628160 ATG A 4605557
chr16 84281750 rs868373747 ATG A 4605558
chr16 84281789 rs60020844 C T 4605559
chr16 84281833 rs111616897 C T 4605560
chr16 84281841 rs148073576 G T 4605561
chr16 84281948 rs67306501 C T 4605562
chr16 84281953 rs572539526 GTTGGGGGCTGGGCATGTTGTTT G 4605563
chr16 84281988 rs60104758 G GGC 4605564
chr16 84282009 rs16944551 C T 4605565
chr16 84282033 rs577278991 T C 4605566
chr16 84282057 rs10580412 TTG T 4605567
chr16 84282057 rs796601478 TTG T 4605568
chr16 84282059 rs72800801 G T 4605569
chr16 84282106 rs374226280 C T 4605570
chr16 84282111 rs56312366 A G 4605571
chr16 84282115 rs61265458 A C 4605572

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results