Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 89068605 89072775 enh91125

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 89071553 rs144134286 A G 4671277
chr16 89071696 rs185667078 G A 4671278
chr16 89071807 rs536028723 C T 4671279
chr16 89071862 rs57055066 GCCAGGCCGCCACTCTGCCTGCGTCCTCCAT G 4671280
chr16 89072014 rs570654642 G A 4671281
chr16 89072026 rs59491329 C T 4671282

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results