Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 8881143 8885253 enh87063

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 8884804 rs71312966 A AAAGCCCTCAAAAGATAAAGTGTAGTAAAGCTAT,AAGATAAAGTGTAGCAAAGCTAT,ACAAA 4739087
chr17 8884857 rs77704145 A G 4739088
chr17 8884925 rs563200723 C T 4739089
chr17 8885261 rs11651654 C G 4739090
chr17 8885306 rs113380120 A G 4739091
chr17 8885330 rs571504767 C T 4739092
chr17 8885501 rs571297327 C G,T 4739093

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results