EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr17:46758358-46758960]
Chromosome characteristics of ZBTB33[chr17:46758358-46758960]
Back to top
Enhancers possibly regulated by ZBTB33[chr17:46758358-46758960]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 46752305 46761275 enh57709
Prostate (PC-3) Brain (SK-N-MC) Ovary Lung (A549) Muscle (A673)
SNP sites on ZBTB33[chr17:46758358-46758960]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 46758398 rs117939956 C T 4911543
chr17 46758462 rs190333033 C T 4911544
chr17 46758682 rs34379978 CT C 4911545
chr17 46758682 rs397857484 CT C 4911546
chr17 46758682 rs544705759 C CTTTT 4911547
chr17 46758790 rs371916836 C T 4911548
chr17 46758793 rs371400890 A T 4911549
chr17 46758837 rs541093910 C T 4911550
chr17 46758847 rs373124148 AGGCGTGAGCCACTGCTCCT A 4911551
chr17 46758847 rs556352275 AGGCGTGAGCCACTGCTCCT A 4911552
chr17 46758850 rs559939551 C T 4911553
Genes possibly regulated by ZBTB33[chr17:46758358-46758960]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr17:46758358-46758960]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results