EnhancerDB
  1. Home
  2. TFBS
  3. MYOD[chr17:47990737-47991493]
Chromosome characteristics of MYOD[chr17:47990737-47991493]
Back to top
Enhancers possibly regulated by MYOD[chr17:47990737-47991493]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 47982025 47996675 enh17210
Prostate (PC-3) Placenta Thyroid Lung (PC-9) Muscle (Myoblast) Epithelial (MCF-7)
SNP sites on MYOD[chr17:47990737-47991493]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 47990751 rs7224931 G T 4918975
chr17 47990842 rs148670504 A G 4918976
chr17 47991015 rs557288 A G 4918977
chr17 47991199 rs577490701 TGGAGGAGGAGGAAGAGGAGGAGGA T 4918978
chr17 47991289 rs572891146 G A 4918979
chr17 47991305 rs78593525 G A 4918980
chr17 47991428 rs201462685 TG T 4918981
chr17 47991428 rs767770888 TG T 4918982
Genes possibly regulated by MYOD[chr17:47990737-47991493]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MYOD[chr17:47990737-47991493]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results