Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 47982025 47996675 enh17210

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 47991015 rs557288 A G 4918977
chr17 47991199 rs577490701 TGGAGGAGGAGGAAGAGGAGGAGGA T 4918978
chr17 47991289 rs572891146 G A 4918979
chr17 47991305 rs78593525 G A 4918980
chr17 47991428 rs201462685 TG T 4918981
chr17 47991428 rs767770888 TG T 4918982
chr17 47991511 rs62077369 G C 4918983
chr17 47991612 rs560758846 A AGGCCACTTTC 4918984
chr17 47991623 rs568203487 A G 4918985
chr17 47991647 rs75111834 G A 4918986
chr17 47991654 rs558967565 G GC,GCCC,GCCCC,GCCCCC 4918987
chr17 47991656 rs534677321 C CCCCCCA,CCCCCCCCCCCG,CCCCCG 4918988
chr17 47991659 rs553351699 C CCCCCCA,CCCCCCCA,CCCCCCCG,CCCCCCCT,CCCCCCG,CCCCCCT 4918989
chr17 47991700 rs562946864 G A 4918990
chr17 47991941 rs573607237 G A,T 4918991
chr17 47992002 rs112767891 A G 4918992
chr17 47992116 rs371392920 C T 4918993
chr17 47992183 rs114489611 C T 4918994

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results