EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr17:63387826-63388522]
Chromosome characteristics of ZNF143[chr17:63387826-63388522]
Back to top
Enhancers possibly regulated by ZNF143[chr17:63387826-63388522]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 63383085 63393035 enh32289
Prostate (PC-3) Blood (T-cell) Astrocyte Thymus Epithelial (MCF-7)
SNP sites on ZNF143[chr17:63387826-63388522]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 63387842 rs79285927 C T 4990717
chr17 63387944 rs369635424 G C 4990718
chr17 63388000 rs191440645 C T 4990719
chr17 63388113 rs9903460 G A 4990720
chr17 63388168 rs12150534 T C 4990721
chr17 63388213 rs79946325 A G 4990722
chr17 63388346 rs566335287 C T 4990723
chr17 63388417 rs537668390 C T 4990724
chr17 63388429 rs560056204 CTGAGTGAGACCTTGTCTCAAAAT C 4990725
Genes possibly regulated by ZNF143[chr17:63387826-63388522]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr17:63387826-63388522]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results