EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:74841099-74841640]
Chromosome characteristics of ZNF274[chr17:74841099-74841640]
Back to top
Enhancers possibly regulated by ZNF274[chr17:74841099-74841640]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 74833505 74848915 enh4610
Bone Marrow (K562) Brain (SK-N-SH) Large Intestine Ovary Blood (OCI-LY7) Muscle (A673) Peripheral Blood (MM.1S) Blood (Karpas-422)
SNP sites on ZNF274[chr17:74841099-74841640]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 74841190 rs7221129 G C 5067700
chr17 74841231 rs544310635 A G 5067701
chr17 74841276 rs577793823 C T 5067702
chr17 74841316 rs540515193 G A 5067703
chr17 74841334 rs146888854 C T 5067704
chr17 74841342 rs59768873 C T 5067705
chr17 74841393 rs78300413 G A 5067706
chr17 74841514 rs117621686 G A 5067707
chr17 74841617 rs559562567 AGGAGGTGGAGGATCACTTGAGCCTG A 5067708
Genes possibly regulated by ZNF274[chr17:74841099-74841640]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:74841099-74841640]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results