Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 74833505 74848915 enh4610

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 74841617 rs559562567 AGGAGGTGGAGGATCACTTGAGCCTG A 5067708
chr17 74841826 rs151090680 T C 5067709
chr17 74841880 rs75263820 C T 5067710
chr17 74841960 rs140755901 C G 5067711
chr17 74842043 rs539230622 C T 5067712

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results