Chrom Start End Enhancer ID Tissues that enhancer appears More
chr18 87225 93075 enh92762

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr18 89213 rs190654753 C A 5128977
chr18 89230 rs150498222 C T 5128978
chr18 89244 rs186147080 T C 5128979
chr18 89294 rs7233781 A C 5128980
chr18 89330 rs544816208 T C 5128981
chr18 89345 rs3132833 G A 5128982
chr18 89373 rs115283137 C T 5128983
chr18 89560 rs568854520 TGGCCTCAGCATCAAGGCCTGGCCCAGAAGGCACTG T 5128984

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results