EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr18:55477401-55478272]
Chromosome characteristics of ZNF274[chr18:55477401-55478272]
Back to top
Enhancers possibly regulated by ZNF274[chr18:55477401-55478272]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr18 55476845 55489580 enh17732
Bone Marrow (K562) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Lung (PC-9) Bone (Osteoblast) Placenta Colon (HCT116) Muscle (Myoblast) Pancreas Spleen Epithelial (MCF-7)
SNP sites on ZNF274[chr18:55477401-55478272]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr18 55477418 rs186250685 A C 5278469
chr18 55477473 rs375393980 T C 5278470
chr18 55477499 rs541577222 G GTATGT 5278471
chr18 55477571 rs544436964 TATTACACATACATATATGTATATA T 5278472
chr18 55477598 rs553186565 GA G 5278473
chr18 55477607 rs9319920 T G 5278474
chr18 55477619 rs115546816 G T 5278475
chr18 55477738 rs574802544 T A 5278476
chr18 55477774 rs9945333 T G 5278477
chr18 55478093 rs375051527 C T 5278478
chr18 55478156 rs535480630 G T 5278479
chr18 55478239 rs11662385 G A 5278480
chr18 55478244 rs34091054 AT A 5278481
chr18 55478244 rs398100901 AT A 5278482
Genes possibly regulated by ZNF274[chr18:55477401-55478272]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr18:55477401-55478272]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results