EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:5433826-5434025]
Chromosome characteristics of ZNF274[chr19:5433826-5434025]
Back to top
Enhancers possibly regulated by ZNF274[chr19:5433826-5434025]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 5432405 5438855 enh32879
Bone Marrow (K562) Astrocyte Prostate (PC-3) Bone (Osteoblast)
SNP sites on ZNF274[chr19:5433826-5434025]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 5433866 rs797423 C T 5409084
chr19 5433868 rs142664718 GAGAGACATAGAGGAAACTGAAATATAGGA G 5409085
chr19 5433912 rs181479731 A G 5409086
chr19 5433944 rs201688645 G GAAA,GAAAAA,GAAAAG 5409087
Genes possibly regulated by ZNF274[chr19:5433826-5434025]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr19:5433826-5434025]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results