EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:6573219-6573936]
Chromosome characteristics of ZNF274[chr19:6573219-6573936]
Back to top
Enhancers possibly regulated by ZNF274[chr19:6573219-6573936]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 6566085 6582575 enh4988
Bone Marrow (K562) Cervix (HeLa-S3) Esophagus Blood (OCI-LY7) Muscle (A673) Colon (HCT116) Peripheral Blood (MM.1S) Blood (Karpas-422) Lung (PC-9) Spleen Blood (T-cell)
SNP sites on ZNF274[chr19:6573219-6573936]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 6573294 rs113579949 G A 5415402
chr19 6573299 rs685587 A G 5415403
chr19 6573317 rs526768 T C 5415404
chr19 6573376 rs381195 A T 5415405
chr19 6573376 rs71174929 A AAT,AT,ATAT 5415406
chr19 6573387 rs75350813 A G 5415407
chr19 6573389 rs144670308 G A,T 5415408
chr19 6573413 rs200894564 A ATATC 5415409
chr19 6573413 rs3042400 A ATATC 5415410
chr19 6573415 rs369626 C A 5415411
chr19 6573419 rs551308836 CTA C 5415412
chr19 6573511 rs72993079 C T 5415413
chr19 6573604 rs116596546 A G 5415414
chr19 6573885 rs567664221 GGTTAAGAAGCAGAAAGTTTAATAGGCAGAAGAAAGGA G 5415415
Genes possibly regulated by ZNF274[chr19:6573219-6573936]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr19:6573219-6573936]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results