Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 38368766 38369153 vista31087

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 38368966 rs542156065 ATATAATAATGCCAGGTCAACTTT A 5658500

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results