Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 40849092 40849491 vista31184

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 40849435 rs12995661 A C 5676149
chr2 40849440 rs556411668 GGATGTAGGATAGATAAAACAATTAA G 5676150

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results