Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 238299841 238300132 vista35398

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 238299850 rs367726517 A AGGAGGAACTGCAGAGTGAT 6479088
chr2 238299850 rs368511244 A AGGAGGAACTGCAGAGTGAT 6479089
chr2 238299850 rs576020921 A AGGAGGAACTGCAGAGTGAT 6479090

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results