Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 38029645 38037655 enh75625

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 38036719 rs139026293 TTAAGGAAGACAGTTGCAATAC T 3894048
chr15 38036719 rs369517861 TTAAGGAAGACAGTTGCAATAC T 3894049

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results