EnhancerDB
  1. Home
  2. TFBS
  3. DUXA[chr15:40541459-40541472]
Chromosome characteristics of DUXA[chr15:40541459-40541472]
Back to top
Enhancers possibly regulated by DUXA[chr15:40541459-40541472]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 40533465 40543955 enh16062
Prostate (PC-3) Brain (SK-N-SH) Large Intestine Prostate (RWPE1) Esophagus Placenta Lung (PC-9) Muscle (Myotube) Epithelial (MCF-7)
SNP sites on DUXA[chr15:40541459-40541472]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 40541464 rs562832434 TTAGGTTTCAACAGATGAATCTTGGGGGACA T 3911532
Genes possibly regulated by DUXA[chr15:40541459-40541472]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr15 40542865 40545170 - C15orf56 ENSG00000176753.3 40545170 0.93 1.0 3698 13804
Expression level of Genes
Back to top
miRNAs possibly regulated by DUXA[chr15:40541459-40541472]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results