Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 40533465 40543955 enh16062

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 40541464 rs562832434 TTAGGTTTCAACAGATGAATCTTGGGGGACA T 3911532

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr15 40542865 40545170 - C15orf56 ENSG00000176753.3 40545170 0.93 1.0 3699 13804


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results