Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
---|---|---|---|---|---|
chr15 | 40533465 | 40543955 | enh16062 |
|
Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr15 | 40541464 | rs562832434 | TTAGGTTTCAACAGATGAATCTTGGGGGACA | T | 3911532 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|---|---|---|---|---|---|---|---|---|---|---|
chr15 | 40542865 | 40545170 | - | C15orf56 | ENSG00000176753.3 | 40545170 | 0.93 | 1.0 | 3699 | 13804 |
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|