Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 41034145 41038615 enh51978

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 41036880 rs546704230 GAGGTAGAGCTCTTTCTGCAGT G 3913907

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results