Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 41980145 41986075 enh3547

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 41984911 rs529064415 TTCCTTTTTCTTTTTTTGAG T 3918884

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results