Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 43539832 43544400 enh31332

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 43543450 rs529017709 GCTCTGCAGCTGCAGAGGAGTAAT G 3924305

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results