EnhancerDB
  1. Home
  2. TFBS
  3. MYB[chr15:44376897-44376902]
Chromosome characteristics of MYB[chr15:44376897-44376902]
Back to top
Enhancers possibly regulated by MYB[chr15:44376897-44376902]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 44371545 44377255 enh31337
Astrocyte
SNP sites on MYB[chr15:44376897-44376902]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 44376901 rs367755831 GAATTGTACACTTTAAATTTA G 3926453
chr15 44376901 rs373757914 GAATTGTACACTTTAAATTTA G 3926454
Genes possibly regulated by MYB[chr15:44376897-44376902]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MYB[chr15:44376897-44376902]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results