EnhancerDB
  1. Home
  2. TFBS
  3. NR2F1[chr15:45067514-45067527]
Chromosome characteristics of NR2F1[chr15:45067514-45067527]
Back to top
Enhancers possibly regulated by NR2F1[chr15:45067514-45067527]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 45066205 45070355 enh3572
Blood (Karpas-422)
SNP sites on NR2F1[chr15:45067514-45067527]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 45067515 rs377333425 CTCCTGACCTTGTGACCCACCT C 3928579
chr15 45067515 rs550477114 CTCCTGACCTTGTGACCCACCT C 3928580
Genes possibly regulated by NR2F1[chr15:45067514-45067527]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NR2F1[chr15:45067514-45067527]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results