Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 45377825 45383835 enh16091

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 45380719 rs559895070 T TTTTCCCCATGGGGAAACATGGG 3930554

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results