Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 56064637 56069815 enh16150

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 56064705 rs553259354 GCTGCAGTGAGCCATGATGGTGCCA G 3969007

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results