Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 57238705 57245483 enh3609

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 57245093 rs561873885 TTTAAATAGTGGTGAGAACAGATATCC T 3974540

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results