Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 58582505 58589035 enh3618

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 58586587 rs568988157 TTCACCTGAAACTCTCACCTGC T 3984984
chr15 58586587 rs8028761 T C 3984985

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results