EnhancerDB
  1. Home
  2. TFBS
  3. GLI2[chr15:58776898-58776910]
Chromosome characteristics of GLI2[chr15:58776898-58776910]
Back to top
Enhancers possibly regulated by GLI2[chr15:58776898-58776910]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 58774985 58787482 enh16177
Bone Marrow (K562) Blood (T-cell) Muscle (A673) Placenta Spleen Muscle (Myotube) Thymus Heart
SNP sites on GLI2[chr15:58776898-58776910]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 58776902 rs149210582 CCCACACTCCTACCGTCGGG C 3987443
chr15 58776902 rs61024382 CCCACACTCCTACCGTCGGG C 3987444
chr15 58776902 rs779118744 CCCACACTCCTACCGTCGGG C 3987445
Genes possibly regulated by GLI2[chr15:58776898-58776910]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by GLI2[chr15:58776898-58776910]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results