Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 62068605 62074775 enh112420

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 62070105 rs111372446 A C 4007730
chr15 62070107 rs529288874 CCTTCCCCAGAGCCAGGGTAACGGTGTTTACTTA C 4007731

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results