Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 64574286 64580957 enh94936

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 64578512 rs563805527 C A 4025015
chr15 64578519 rs566866724 G GATATTGTTAACATGTTATTGTTAACA 4025016

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results