Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 67901825 67909795 enh52054

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 67908037 rs537996485 A C 4046054
chr15 67908041 rs540167624 TTTAAAAATTATATTTTTCATTAGCTGA T 4046055

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results