Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 68575705 68579875 enh52060

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 68576685 rs139085346 TATTTGGTATAAATTACCAAAGTA T 4050162

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results