EnhancerDB
  1. Home
  2. TFBS
  3. TFAP2C[chr15:69685771-69685786]
Chromosome characteristics of TFAP2C[chr15:69685771-69685786]
Back to top
Enhancers possibly regulated by TFAP2C[chr15:69685771-69685786]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 69680546 69689415 enh16276
Prostate (PC-3) Cervix (HeLa-S3) Brain (SK-N-MC) Prostate (RWPE1) Ovary Astrocyte Muscle (A673) Placenta Thyroid Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Kidney
SNP sites on TFAP2C[chr15:69685771-69685786]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 69685772 rs148862016 TGGCCTCAGGGCAGTCACTGTCCACTCTG T 4058720
chr15 69685772 rs371720998 TGGCCTCAGGGCAGTCACTGTCCACTCTG T 4058721
chr15 69685772 rs753484366 TGGCCTCAGGGCAGTCACTGTCCACTCTG T 4058722
chr15 69685772 rs760741328 TGGCCTCAGGGCAGTCACTGTCCACTCTG T 4058723
chr15 69685772 rs764111305 TGGCCTCAGGGCAGTCACTGTCCACTCTG T 4058724
chr15 69685772 rs774212136 TGGCCTCAGGGCAGTCACTGTCCACTCTG T 4058725
Genes possibly regulated by TFAP2C[chr15:69685771-69685786]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TFAP2C[chr15:69685771-69685786]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results