Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 70278021 70292535 enh3695

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 70288252 rs67903341 TGACTCAAGCAGGGCCTGCAGAGCCCTTCCTAGG T 4063515
chr15 70288252 rs72136232 TGACTCAAGCAGGGCCTGCAGAGCCCTTCCTAGG T 4063516

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results