Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 1546424 1546775 vista54789

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 1546636 rs146912250 TGTTGACATTCACACGTACCTGTG T 9573117

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results