Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
---|---|---|---|---|---|
chr1 | 992241 | 1006235 | enh11407 |
|
Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr1 | 997436 | rs145846158 | CTCCCTCCCTTGTCCCCGTTCCCTCCG | C | 2454 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|