Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 2027425 2033575 enh11418

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 2029549 rs148361309 C CAGGTGACCAGGAGTGACTA 10854
chr1 2029549 rs55716481 C CAGGTGACCAGGAGTGACTA 10855

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results